NAME
Bio::Grep::Benchmarks - Bio::Grep Benchmarks
DESCRIPTION
A collection of quick and dirty benchmarks.
BENCHMARKS
2 x Intel(R) Xeon(TM) CPU 2.40GHz, 1GB RAM. Fedora Core 6.
TAIR7_cdna_20070425 (Arabidopsis CDNA Fasta file, 52MB).
Bio::Grep v0.10.1.
Database Generation
Average over 2 iterations.
GUUGle : 11.75 sec
Agrep/RE : 24.36 sec
Vmatch (-pl 3) : 187.65 sec
Mismatches
Query: ugacagaagagagugagcac (revcom)
Average over 20 iterations.
- No mismatches (exact matching):
-
Agrep (Wu-Manber): 0.60 sec Vmatch : 2.81 sec RE : 1.82 sec Vmatch (-online) : 4.14 sec GUUGle : 10.13 sec Agrep (TRE) : 15.96 secNote that
Vmatchneeds one slow run to load the suffix arrays in memory (Values are the average over 20 iterations). Also note that GUUGle allows GU mismatches. - One mismatch:
-
Vmatch : 0.15 sec Agrep (Wu-Manber): 1.09 sec Vmatch (-online) : 4.21 sec Agrep (TRE) : 47.01 sec GUUGle : n/a RE : n/a - Two mismatches:
-
Vmatch : 0.20 sec Agrep (Wu-Manber): 1.44 sec Vmatch (-online) : 4.33 sec Agrep (TRE) : 59.17 sec GUUGle : n/a RE : n/a - Three mismatches:
-
Vmatch : 0.46 sec Agrep (Wu-Manber): 1.93 sec Vmatch (-online) : 4.78 sec Agrep (TRE) : 72.56 sec GUUGle : n/a RE : n/a - Four mismatches:
-
Vmatch : 1.65 sec Agrep (Wu-Manber): 2.29 sec Vmatch (-online) : 5.27 sec Agrep (TRE) : 83.50 sec GUUGle : n/a RE : n/a - Five mismatches:
-
Agrep (Wu-Manber): 2.95 sec Vmatch : 6.90 sec Vmatch (-online) : 9.00 sec Agrep (TRE) : 96.16 sec GUUGle : n/a RE : n/a
FEEDBACK
The script that generated these benchmarks is available in the examples directory of this distribution.
Please report any bugs, feature requests and benchmarks to bug-bio-grep@rt.cpan.org, or through the web interface at http://rt.cpan.org.
AUTHOR
Markus Riester, <mriester@gmx.de>
LICENCE AND COPYRIGHT
Copyright (C) 2007 by M. Riester. All rights reserved.
This module is free software; you can redistribute it and/or modify it under the same terms as Perl itself.